View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5119_high_9 (Length: 243)
Name: NF5119_high_9
Description: NF5119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5119_high_9 |
 |  |
|
| [»] scaffold0155 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0155 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 64 - 224
Target Start/End: Complemental strand, 37601 - 37441
Alignment:
| Q |
64 |
ggtataggatatttgtttaacattcattatttcnnnnnnnaaaaatctcaatgaacattaaagttggtgcccgattttgttatggtaactgtcttcctct |
163 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37601 |
ggtataggatatttgtttcacattctttatttcttttttaaaaaatctcaatgaacattaaagttggtgcccgattttgttatggtaactgtcttcccct |
37502 |
T |
 |
| Q |
164 |
tctcagtctcaaatgttgttgaaggaaatgaatgacaaaataaaggagtaaaataatgttc |
224 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37501 |
tctctgtctcaaatgttgttgaaggaaatgaatgacaaaataaaggagtaaaataatgttc |
37441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 64 - 216
Target Start/End: Original strand, 22361744 - 22361900
Alignment:
| Q |
64 |
ggtataggatatttgtttaacattcat-tatttcnnnnnnnaaaaa-tctcaatgaacattaaagttggtgcccgattttgttatggtaactgtcttcct |
161 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||||| | ||||||||||| ||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
22361744 |
ggtataggatatttgtttcacattcatgtatttcttttttaaaaaaatttcaatgaacatgaaaattggtgccccatttttttatggtaactgtcttcct |
22361843 |
T |
 |
| Q |
162 |
cttctcagtctcaaatgttgttgaaggaaatgaatgacaa--aataaaggagtaaaa |
216 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| || |||||||||| |||| |
|
|
| T |
22361844 |
cttctctatctcaaatgttgttgaatttaatgaatgaaaaccaataaaggagaaaaa |
22361900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 175 - 224
Target Start/End: Complemental strand, 2662307 - 2662258
Alignment:
| Q |
175 |
aatgttgttgaaggaaatgaatgacaaaataaaggagtaaaataatgttc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2662307 |
aatgttgttgaaggaaatgaatgacaaaataaaggagtaaaataatgttc |
2662258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 96
Target Start/End: Complemental strand, 2662371 - 2662339
Alignment:
| Q |
64 |
ggtataggatatttgtttaacattcattatttc |
96 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
2662371 |
ggtataggatatttgtttcacattcattatttc |
2662339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University