View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5120-Insertion-3 (Length: 501)
Name: NF5120-Insertion-3
Description: NF5120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5120-Insertion-3 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 488; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 488; E-Value: 0
Query Start/End: Original strand, 10 - 501
Target Start/End: Original strand, 8124634 - 8125125
Alignment:
| Q |
10 |
attaaggcaagctataacactttaactctagagcttaaagttcagaccttttttgatgatatattcataaacttgttcaattatgtatgtaaagtgcaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124634 |
attaaggcaagctataacactttaactctagagcttaaagttcagaccttttttgatgaaatattcataaacttgttcaattatgtatgtaaagtgcaga |
8124733 |
T |
 |
| Q |
110 |
tatgagagcttgcacttaaataggataaatggtatggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124734 |
tatgagagcttgcacttaaataggataaatggtatggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggac |
8124833 |
T |
 |
| Q |
210 |
ctaccatttatgctccacatttagcactacatcaaggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatcct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124834 |
ctaccatttatgctccacatttagcactacatcaaggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatcct |
8124933 |
T |
 |
| Q |
310 |
tctctttggtcattgtttgtgttggtctggttggattgtgatgcaagcatttgttctgaaaaagtactcagcacaactcacagtttctgcttttacttgc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124934 |
tctctttggtcattgtttgtgttggtctggttggattgtgatgcaagcatttgttctgaaaaagtactcagcacaactcacagtttctgcttttacttgc |
8125033 |
T |
 |
| Q |
410 |
ttctttggtattgtgcagtttgggacaattgcagcctttcttgagaaggatcccaaagcttggcagctcaattccattgaagaggcctacag |
501 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8125034 |
ttctttggtattgtgcagtttgggacaattgcagcctttcttgagaaggatcccaaagcttggcagctcaattccattgaagaggcctacag |
8125125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University