View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5120_high_11 (Length: 204)
Name: NF5120_high_11
Description: NF5120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5120_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 31 - 187
Target Start/End: Original strand, 43327009 - 43327165
Alignment:
| Q |
31 |
tttaattgttaaaaaagcaacaaacctgtatcagagatgagtccagtccgaagcatctgaggtatggatgcaatcaaaagatatgatgcaagcatggctg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327009 |
tttaattgttaaaaaagcaacaaacctgtatcagagatgagtccagtccgaagcatctgaggtatggatgcaatcaaaagatatgatgcaagcatggctg |
43327108 |
T |
|
| Q |
131 |
gccaaaacccagcagtagggataccaaacttgcttgccacttgtatggcccaagatg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327109 |
gccaaaacccagcagtagggataccaaacttgcttgccacttgtatggcccaagatg |
43327165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University