View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5120_high_3 (Length: 372)
Name: NF5120_high_3
Description: NF5120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5120_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 334
Target Start/End: Complemental strand, 9269212 - 9268875
Alignment:
| Q |
1 |
aatctcgctcatctcttcagccatgattttactactccactttcacattcaacccttttcttcaaattatttaattataaatcatctcaagttcaacttt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
9269212 |
aatctcgctcatctcttcggccatgattttaatactccactttcacattcaagccttttcttcaaattatttaatcataaatcatctcaaattcagcttt |
9269113 |
T |
 |
| Q |
101 |
ttcatgggtgtctttcaaagaaccttaaagaannnnnnnaatccacaaatttgttaatttttcagaaattggtttgattgtgctcatgatctttccacct |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9269112 |
ttcatgggtgtctttgaaagaaccttaaagaatttttttaatccacaaatttgttaatttttcagaaattggtttgattgtgctcatgatctttccacct |
9269013 |
T |
 |
| Q |
201 |
tgtttgttatatggaagttcaaaattttggggttttagagattgatttggaaaacagtgttg----tttatgaagggcgaagacaaattcttttttaggg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
9269012 |
tgtttgttatatggaagttcaaaattttggggtttttgagattgatttggaaaacatagttgtttttttattaagggcgaagacaatttcttttttaggg |
9268913 |
T |
 |
| Q |
297 |
gagaactgttattattgagatggattgagaaagaaata |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9268912 |
gagaactgttattattgagatggattgagaaagaaata |
9268875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University