View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5121_low_12 (Length: 231)
Name: NF5121_low_12
Description: NF5121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5121_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 39 - 217
Target Start/End: Original strand, 41637754 - 41637932
Alignment:
| Q |
39 |
acatgtagagtgtatatgtcttccgtccgcatgaaggcgactacatcactggtgggttaagcttgtttgatttgacaaaaatatcaaattgtatcttgtt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637754 |
acatgtagagtgtatatgtcttccgtccgcatgaaggcgactacatcactggtgggttaagcttgtttgatttgacaaaaatatcaaattgtatcttgtt |
41637853 |
T |
|
| Q |
139 |
tattcgttggctgattactatgtgtatagaattggagtttatttaatattgtnnnnnnnttattttccctcatattctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41637854 |
tattcgttggctgattactatgtgtatagaattggagtttatttaatatgataaaaaaattattttccctcatattctt |
41637932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University