View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5121_low_9 (Length: 247)
Name: NF5121_low_9
Description: NF5121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5121_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 51805662 - 51805427
Alignment:
| Q |
4 |
atcaaacctatgcagaatttattaaaaatcgactaaatttcaagtacgattaaaaatgattattactgaattagcttgactaaccattattaattaatta |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805662 |
atcaaatctatgcagaatttattaaaaatcgactaaatttcaagtacgattaaaaatgattattactgaattagcttgactaaccattattaattaatta |
51805563 |
T |
|
| Q |
104 |
aatttacaagttgtagcagtgagatagtta-tttgactatcaaaatttaaaattggtgaatgatatgatcctgttttgtaaccaagtacaaggcctgaac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805562 |
aatttacaagttgtagcagtgagatagttattttgactatcaaaatttaaaattggtgaatgatatgatcctgttttgtaaccaagtacaaggcctgaac |
51805463 |
T |
|
| Q |
203 |
atgacttgcaccattttttcttgtaggtgttgattt |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51805462 |
atgacttgcaccattttttcttgtaggggttgattt |
51805427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University