View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5122-Insertion-6 (Length: 110)
Name: NF5122-Insertion-6
Description: NF5122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5122-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 8e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 8e-37
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 2660723 - 2660823
Alignment:
| Q |
7 |
agaactataccaaaacaccactccaatttcacttcactagggtagaatttcttatcttcttccttttctcacaaattcatcttttagatctaaattcttt |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2660723 |
agaattataccaaaacaccactccaatttcacttcactacggtagagtttcttatcttct---ttttctcacaaattcatcttttagatctaaattcttt |
2660819 |
T |
|
| Q |
107 |
ttca |
110 |
Q |
| |
|
|||| |
|
|
| T |
2660820 |
ttca |
2660823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University