View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5125-Insertion-15 (Length: 210)
Name: NF5125-Insertion-15
Description: NF5125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5125-Insertion-15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 8 - 202
Target Start/End: Complemental strand, 25669580 - 25669384
Alignment:
| Q |
8 |
cttgttctgtttttgacattgtgaataagtgttattatgaaaatgttctataatatattagttctagagtttgaatttgatgccaaaacatgagtagcat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25669580 |
cttgttctgtttttgacattgtgaataagtgttgttatgaaaatgttctataatatacatattctagagtttgaatttgatgccaaaacatgagtagcat |
25669481 |
T |
 |
| Q |
108 |
gattaagttatgtgttgtgaatgtcacatgatgacatgaaaaaactaaattgtatttcagtct--tgagggttttctgctgaatgaactagtttttt |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| | | ||| |||||||||||||||||||||||| |
|
|
| T |
25669480 |
gattaagttatgggttgtgaatgtcacatgatgacatgaaaaaactaaattgtatttaagtataattcaggtcttctgctgaatgaactagtttttt |
25669384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University