View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5125_high_13 (Length: 227)
Name: NF5125_high_13
Description: NF5125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5125_high_13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 36590607 - 36590376
Alignment:
| Q |
1 |
tgaattgttggattctttattattttatgaagtttgttaatggtgatttacttca----------caaattggaagaatagtccaatacttggaactggt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
36590607 |
tgaattgttggattctttattattttatgaagtttgttaatggtgatttacttcatgttgcttcacaaattggaagaatagtccaatacttggaattggt |
36590508 |
T |
|
| Q |
91 |
tatattttctttcaaatggaagttcatgaaaaaatatcaattatcactggctaatgtctgctttaagagattaacgatttaagtgtttctatgtatgata |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
36590507 |
tatattttctttcaaatggaagttcatgaaaaaatatcaattatcactggctaatgtcagc-----gagattaacgatttaagtgtttctatgtatgata |
36590413 |
T |
|
| Q |
191 |
gtttgaaaatgtatttctacttgttattggtcattgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36590412 |
gtttgaaaatgtatttctacttgttattggtcattgt |
36590376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University