View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5125_low_15 (Length: 217)
Name: NF5125_low_15
Description: NF5125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5125_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 210
Target Start/End: Original strand, 6285602 - 6285807
Alignment:
| Q |
7 |
catcatcatcttcttctacttcaaaaggtgaacattttggaagaacatgaatatcttcagaaatagatcccatgttttggtttcttttagttt--gagtt |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6285602 |
catcatcatcttctactacttcaaaaggtgaacattttggaagaacatgaatatcttcagaaatagatcccatgttttggtttcttttagtttttgagtt |
6285701 |
T |
|
| Q |
105 |
tacaatgcatgttggtaacatgcatttatatcatatatgtattgatcttattggtgaaagttattacctatgttgtatatgtttgtctttaagtgtgtga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6285702 |
tacaatgcatgttggtaacatgcatttatatcatatatgtattgatcttattggtgaaagttattacctatgttgtatatgtttgtctttaagtgtgtga |
6285801 |
T |
|
| Q |
205 |
tgatgt |
210 |
Q |
| |
|
|||||| |
|
|
| T |
6285802 |
tgatgt |
6285807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University