View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5126-Insertion-2 (Length: 255)
Name: NF5126-Insertion-2
Description: NF5126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5126-Insertion-2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 255
Target Start/End: Complemental strand, 11321772 - 11321535
Alignment:
| Q |
8 |
ctccaatgctacttcaagtatgaagttaacaatgatgactgccaaggagatgaaggctgcggttaagagagtctttcccgaagaaatggccaaactc-gc |
106 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||| ||||||||||| ||||| |||||| |||||||||||||||||||||| |||||| || |
|
|
| T |
11321772 |
ctccaacgttacttcaagtaagaagttaacaatgatgactgctaaggagatgaatgctgccgttaagggagtctttcccgaagaaatggctaaactcagc |
11321673 |
T |
 |
| Q |
107 |
cctctcagcggctatcgtacctgtaaccagttttggtattgaccaattgtgtgatacaattgataaaaccgtgatatagatgttggattctttcttctct |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11321672 |
cctctcca----------acctgtaaccagttttggtatcgatcaattgtgcaatacaattgataaaaccgtgatatagatgttggattctttcttctct |
11321583 |
T |
 |
| Q |
207 |
ataatgtgcacagaaagttcagttggaattaatatgttttgttgaaaag |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11321582 |
ataatgtgcacagaaagttcagttggaattaatatg-tttgttgaaaag |
11321535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University