View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5126_high_9 (Length: 325)
Name: NF5126_high_9
Description: NF5126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5126_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 4568366 - 4568509
Alignment:
| Q |
1 |
atattaactgcattgtttgcttcatttttagctagccgaatgtatttttagatggcccttatggttctttcaattttcaagtcaaagagtaaggtacctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4568366 |
atattaactgcattgtttgcttcatttttagctagccgaatgtatttttagatggccctcatggtcctttcaattttcaagtcaaagagtaaggtacctg |
4568465 |
T |
|
| Q |
101 |
aatctgcaccacgcatgaacaaatctttagtagagtcgcgtgat |
144 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
4568466 |
aatctgcaccatgaatgaacaaatctttagtagagtcgcgtgat |
4568509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 185 - 228
Target Start/End: Original strand, 4568550 - 4568593
Alignment:
| Q |
185 |
gatttttataagatgaaataaaactgaaactaatcattgtttta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4568550 |
gatttttataagatgaaataaaactgaaactaatcattgtttta |
4568593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University