View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5127_high_4 (Length: 219)
Name: NF5127_high_4
Description: NF5127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5127_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 46 - 202
Target Start/End: Original strand, 28659808 - 28659964
Alignment:
| Q |
46 |
tttcatccaaaacgtcatcgaatcttatcataggttctcttactatttctttacttttcccggaacaattaaagtcagacgcaaaagaataaatttcaga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28659808 |
tttcatccaaaacgtcatcgaatcttatcataggttctcttactctttttttacttttcccggaacaattaaagtcagacgcaaaagaataaatttcaga |
28659907 |
T |
 |
| Q |
146 |
tgttagagacaaaactcgatttatctttatacctgcatcaaatagatatgtggttcc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28659908 |
tgttagagacaaaactcgatttatctttgtacctgcatcaaatagatatgtggttcc |
28659964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University