View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5128_high_1 (Length: 594)
Name: NF5128_high_1
Description: NF5128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5128_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 548; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 548; E-Value: 0
Query Start/End: Original strand, 20 - 587
Target Start/End: Original strand, 43672168 - 43672735
Alignment:
| Q |
20 |
actaaacccaactccgacaccgctaactttgttctcaaccacttcacttccttaaaccttaaaacccacacaacatcttacaacgttcttctctcttatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672168 |
actaaacccaactccgacaccgctaactttgttctcaaccacttcatttccttaaaccttaaaacccacacaacatcttacaacgttcttctctcttatc |
43672267 |
T |
|
| Q |
120 |
cattacactcttcactctccatgcactttaacgatggttcatcttccaaccttggattaaccgaaccgggttcatccggttcagacatggttcatgccta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43672268 |
cattacactcttcactctccatgcactttaacgatggttcatcttccaaccttggattaaccgaaccgggttcatctggttcagacatggttcatgccta |
43672367 |
T |
|
| Q |
220 |
ccatgcttactcaccatccggttcagtttatgctaaggcggtgtttgtgaactacggaagagatagagactaccgtgcagttggcgtaagcattaaggga |
319 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672368 |
ccatgcttattcaccatccggttcagtttatgctaaggcggtgtttgtgaactacggaagagatagagactaccgtgcagttggcgtaagcattaaggga |
43672467 |
T |
|
| Q |
320 |
tgtatagtgatagtaagaaaaggtggtggtttagggaggaacacggtggttgaaaaggctgaggaaaacggtgctgtagcggttctggtttataatgatg |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43672468 |
tgtatagtgatagtaagaaaaggtggtggtttagggaggaacacggtggttgaaaaggctgaggaaaacggtgctgtagcggttctagtttataatgatg |
43672567 |
T |
|
| Q |
420 |
agaatgacacgtggcgtgatgggtttgagagaggtcacgtgatgaaaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaa |
519 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672568 |
agaatgacacgtggcgtaatgggtttgagagaggtcacgtgatgaaaggtgtaggggacccacttagtcctggttggggtagtgttgaaggtagtgagaa |
43672667 |
T |
|
| Q |
520 |
gttgagtttggatgataatgaagttttgaaaaggttccctaaaattccatctatgccactctctgctc |
587 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672668 |
gttgagtttggatgataatgaagttttgaaaaggttccctaaaattccatctatgccactctctgctc |
43672735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University