View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5128_high_6 (Length: 258)
Name: NF5128_high_6
Description: NF5128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5128_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 24 - 241
Target Start/End: Original strand, 37381324 - 37381529
Alignment:
| Q |
24 |
agaaaacgcatccctaacatggacgagtttaattttggtacttgaaaacattaaggacacaccaaggacacacaaaggaccaccaatgannnnnnnnnnn |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37381324 |
agaaaacgcatccctaacatggacgagtttaattttggtacttgaaaacat-----------caaggacacacaaaggaccaccaatgacccccctcccc |
37381412 |
T |
 |
| Q |
124 |
nntaatacacgttagctcaagtagcaatccaaaaatgagataaaaataaggcgattgctcatacaaccccctaaaaatgcaggatcttatcggaagctag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37381413 |
c-taatacacgttagctcaagtagcaatccaaaaatgagataaaaataaggcgattgctcatacaaccccctaaaaatgcaggatcttatcggaagctag |
37381511 |
T |
 |
| Q |
224 |
tttccgacaatgtaaata |
241 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
37381512 |
tttcccacaatgtaaata |
37381529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 31124310 - 31124346
Alignment:
| Q |
187 |
caaccccctaaaaatgcaggatcttatcggaagctag |
223 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31124310 |
caaccccctaaaaatgcgggatcttatccgaagctag |
31124346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 36634613 - 36634649
Alignment:
| Q |
176 |
gattgctcatacaaccccctaaaaatgcaggatctta |
212 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
36634613 |
gattgctcatacaaccccttgaaaatgcaggatctta |
36634649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University