View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5129_low_7 (Length: 253)
Name: NF5129_low_7
Description: NF5129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5129_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 52590224 - 52589988
Alignment:
| Q |
1 |
acatgtttggcaatactcatctgttgcatgaatttgtcgtatgaaaatctaccaaagatannnnnnnnnnnnnnactaaaggtatcttatctctgaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52590224 |
acatgtttggcaatactcatctgttgcatgaatttgtcgtatgaaaatctaccaaagatatttttcatttttt-actaaaggtatcttatctctgaaagg |
52590126 |
T |
 |
| Q |
101 |
tgtacttcctcaaaccatatgctgttgttttttaattccattcattcattcgcgttgccctcattgttcataaaagtgatgtaattcacaaacgtacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52590125 |
tgtacttcctcaaaccatatgctgttgttttttaattc-attcattcattcgcgttgccctcattgttcataaaagtgatgtaattcacaaacgtacaaa |
52590027 |
T |
 |
| Q |
201 |
atatacagataggtatatatatgtgttagatatattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52590026 |
atatacagataggtatatatatgtgttagatatattcat |
52589988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University