View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5130-Insertion-12 (Length: 190)
Name: NF5130-Insertion-12
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5130-Insertion-12 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 93 - 190
Target Start/End: Original strand, 4032107 - 4032204
Alignment:
| Q |
93 |
cttcttcattcttcaaactatttatacatggaagcaaagtacaagcactacctttctcatcctcattatcattgccaaatcctattctcttccttatg |
190 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032107 |
cttcctcattcttcaaactatttatacatggaagcaaagtacaagcactacctttctcatcctcattatcattgccaaatcctattctcttccttatg |
4032204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 99
Target Start/End: Complemental strand, 14135723 - 14135661
Alignment:
| Q |
34 |
gaaattctaattttgccctcacccctatcctctctacatgatcgatttcttcctctcatcttcttc |
99 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
14135723 |
gaaatcctaatttttccctcacccttatcctctctac---atcgatgtcttcctctcatcttcttc |
14135661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University