View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5130-Insertion-15 (Length: 195)
Name: NF5130-Insertion-15
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5130-Insertion-15 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0005 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 194
Target Start/End: Original strand, 226890 - 227077
Alignment:
| Q |
7 |
atattcatcctctggaatgctgttaccatcttcagaagacgcttcaatatccttgaaggctacgcagagtgttctcagtgcatcggaagcaaaaccattg |
106 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
226890 |
atattcatcctccggaatgctgttgccatcttcagaagacgcttcaatatccttgaaggctacacagagtgttctcagtgcatcggaagcaaaaccattg |
226989 |
T |
|
| Q |
107 |
attacttcattgatgctatttctttgttgttcattcaaatcaacaactttaccttctgagttaacaactttgtcacacattttcacca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226990 |
attacttcattgatgctatttctttgttgttcgttcaaatcaacaactttaccttctgagttaacaactttgtcacacattttcacca |
227077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 194
Target Start/End: Complemental strand, 14590488 - 14590301
Alignment:
| Q |
7 |
atattcatcctctggaatgctgttaccatcttcagaagacgcttcaatatccttgaaggctacgcagagtgttctcagtgcatcggaagcaaaaccattg |
106 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14590488 |
atattcatcctccggaatgctgttgccatcttcagaagacgcttcaatatccttgaaggctacacagagtgttctcagtgcatcggaagcaaaaccattg |
14590389 |
T |
|
| Q |
107 |
attacttcattgatgctatttctttgttgttcattcaaatcaacaactttaccttctgagttaacaactttgtcacacattttcacca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14590388 |
attacttcattgatgctatttctttgttgttcgttcaaatcaacaactttaccttctgagttaacaactttgtcacacattttcacca |
14590301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 124 - 194
Target Start/End: Complemental strand, 187951 - 187881
Alignment:
| Q |
124 |
atttctttgttgttcattcaaatcaacaactttaccttctgagttaacaactttgtcacacattttcacca |
194 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||| || ||||||||||| ||||||||||| |||| |
|
|
| T |
187951 |
atttctttgttgttcattaaaatcgacaactttgccttatgcattaacaactttctcacacattttaacca |
187881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University