View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5130-Insertion-16 (Length: 282)
Name: NF5130-Insertion-16
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5130-Insertion-16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 7 - 282
Target Start/End: Original strand, 5179070 - 5179345
Alignment:
| Q |
7 |
aagtcccttgatacccatctccttagatcagaaatttcgtcctcaactatatttggtagctggacattatcttctagctgatacttcatcggccagtcta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
5179070 |
aagtcccttgatacccatctccttagatcagaaatttcgtcctcaactatatttggtagctggacattatcttctagctgatatttcatcggcccgtcta |
5179169 |
T |
|
| Q |
107 |
agatcacattgtcgtttcttaagacggtgtgacatgagagctgttgcttctggtgctctaccaaactccccaacaggctcatattctcttgtacatgatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5179170 |
agatcacattgtcgtttcttaagacggtgtaacatgagagctgttgcttctggtgctctaccaaactccccaacaagctcatattctcttgtacatgatt |
5179269 |
T |
|
| Q |
207 |
taggttatttgaattgtttggcttatggtatgaagtttggttgtcaaaaatactatctatgcttagttgcatttct |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5179270 |
taggttatttgaattgtttggcttatggtatgaagtttggttgtcaaaaatactatctatgcttagttgcatttct |
5179345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University