View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5130-Insertion-19 (Length: 183)
Name: NF5130-Insertion-19
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5130-Insertion-19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 47991736 - 47991561
Alignment:
| Q |
8 |
cataggattaggaaatgattcagctgtgaaaggggttgttgtaattcatggcaaagcttttattggaaggattgataatgattttgtttgtgcaactctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47991736 |
cataggattaggaaatgattcagctgtgaaaggggttgttgtaattcatggcaaagcttttattggaaggattgataatgattttgtttgtgcaactctt |
47991637 |
T |
|
| Q |
108 |
gattggtggcctcctcagaaatgtgactggggaagatgcagttggggtcatgcttctcttcttaatctggtatagt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47991636 |
gattggtggcctcctcagaaatgtgactggggaagatgcagttggggtcatgcttctcttcttaatctggtatagt |
47991561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 69 - 180
Target Start/End: Complemental strand, 22879730 - 22879619
Alignment:
| Q |
69 |
attggaaggattgataatgattttgtttgtgcaactcttgattggtggcctcctcagaaatgtgactggggaagatgcagttggggtcatgcttctcttc |
168 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||| | |||||||||||||||||||||||||| | || | ||| |||||||||| ||||||||||| |
|
|
| T |
22879730 |
attggaaatattgatgatgattttatttgtgcaactttggattggtggcctcctcagaaatgtgattatggtacatgtagttggggtcttgcttctcttc |
22879631 |
T |
|
| Q |
169 |
ttaatctggtat |
180 |
Q |
| |
|
| |||||||||| |
|
|
| T |
22879630 |
tcaatctggtat |
22879619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University