View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5130_high_15 (Length: 203)
Name: NF5130_high_15
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5130_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 65 - 165
Target Start/End: Complemental strand, 39233874 - 39233774
Alignment:
| Q |
65 |
cactattcagcattatcttcatctcacgataacacattcttagcatataatcatgctgtattatgcaacaatcaatgacaattggttacaattttattat |
164 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39233874 |
cactattcagcatgatcttcatctcacgataacacattcttagcatataatcatactgttttatgcaacaatcaatgacaattggttacaattttattat |
39233775 |
T |
|
| Q |
165 |
t |
165 |
Q |
| |
|
| |
|
|
| T |
39233774 |
t |
39233774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 39233641 - 39233611
Alignment:
| Q |
157 |
tttattattttgccgcctggttgttctctgt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39233641 |
tttattattttgccgcctggttgttctctgt |
39233611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University