View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5130_low_10 (Length: 276)
Name: NF5130_low_10
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5130_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 7456525 - 7456765
Alignment:
| Q |
18 |
aaagctaacagcatcgttcacttttttcagtcgacactttaattattgtatattaagccggcgctaagcagacactacgatctattaataaatagttgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7456525 |
aaagctaacagcatcgttcacttttttcagtcgacactttaattattgtatattaagccggcgctaagcagacactacgatctattaataaataattgac |
7456624 |
T |
 |
| Q |
118 |
actaacaatagtgtcagatgcaccgacactagtgagcctcggtcaggcccacattattgttgtaatttaagcttttagcgtcaaagagcccacgctaatg |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7456625 |
actaacaatagtgtcagatacaccgacactagtgagcctcggtcaggcccacattattgttgtaatttaagcttttagcgtcaaagag-ccacgctaatg |
7456723 |
T |
 |
| Q |
218 |
tcaaaatatatttaaaaaagttgcattagtgaaatacagtct |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7456724 |
tcaaaatatatttaaaaaagttgcagcagtgaaatacagtct |
7456765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University