View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5130_low_12 (Length: 251)
Name: NF5130_low_12
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5130_low_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 32 - 251
Target Start/End: Original strand, 43399394 - 43399606
Alignment:
| Q |
32 |
tccattatgaaaattcttactccgaattgatggcctataagaaaagaagcactgccagcagaattgttaattgctaagtgctttattaacttctttagat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
43399394 |
tccattatgaaaattcttactccgaattgatggcctataagaaaagaagcactgccagcagaattgttaattgctaagtgct---ttagcttctttagat |
43399490 |
T |
 |
| Q |
132 |
tttcccctctcctcaaacaaatcatgattacacattcgataatgtatatatgttttgtaacaataggcttttaatggttgtaaatttgttaggccaagct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43399491 |
tttcccctctcctcaaacaaatcatgattacacattcgataatg----tatgttttgtaacaataggcttttaatggttgtaaatttgttaggccaagct |
43399586 |
T |
 |
| Q |
232 |
caactatatcctaatctttc |
251 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43399587 |
caactatatcctaatctttc |
43399606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University