View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5130_low_17 (Length: 207)

Name: NF5130_low_17
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5130_low_17
NF5130_low_17
[»] chr5 (1 HSPs)
chr5 (8-200)||(29666735-29666927)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 29666927 - 29666735
Alignment:
8 ctctttttggtaaacattataagacaaggtttaggagagagttgttggggaaagtttacgtataaatattaatgaagtggtcaagattaggtggatatat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29666927 ctctttttggtaaacattataagacaaggtttaggagagagttgttggggaaagtttacgtataaatattaatgaagtggtcaagattaggtggatatat 29666828  T
108 catctgcagacatttataggaattattaggaacatatgtacggggtagttgctatgaacattgtatttgacatttttgcttttagaataattt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||    
29666827 catctgcagacatttataggaattattaggaacatatgtacggggtagttgctatgaaaattgtatttgacatttttgcttttagagtaattt 29666735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University