View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5130_low_18 (Length: 203)

Name: NF5130_low_18
Description: NF5130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5130_low_18
NF5130_low_18
[»] chr2 (2 HSPs)
chr2 (65-165)||(39233774-39233874)
chr2 (157-187)||(39233611-39233641)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 65 - 165
Target Start/End: Complemental strand, 39233874 - 39233774
Alignment:
65 cactattcagcattatcttcatctcacgataacacattcttagcatataatcatgctgtattatgcaacaatcaatgacaattggttacaattttattat 164  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||    
39233874 cactattcagcatgatcttcatctcacgataacacattcttagcatataatcatactgttttatgcaacaatcaatgacaattggttacaattttattat 39233775  T
165 t 165  Q
    |    
39233774 t 39233774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 39233641 - 39233611
Alignment:
157 tttattattttgccgcctggttgttctctgt 187  Q
    |||||||||||||||||||||||||||||||    
39233641 tttattattttgccgcctggttgttctctgt 39233611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University