View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5131_high_7 (Length: 253)
Name: NF5131_high_7
Description: NF5131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5131_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 45304366 - 45304483
Alignment:
| Q |
1 |
tattccttaaaagactttttggtgattgattaagggaggaatgtcccaacccaaagttgtaaaggaaaaagagatggtatttgtctgg-ttagtacatac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45304366 |
tattccttaaaagactttttggtgattgattaagggaggaatgtcccaacccaaagttgtaaaggaaaaagagatggtatttgtctggtttagtacatac |
45304465 |
T |
 |
| Q |
100 |
atgcatgatgatgaatga |
117 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45304466 |
atgcatgatgatgaatga |
45304483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 146 - 237
Target Start/End: Original strand, 45304522 - 45304613
Alignment:
| Q |
146 |
atagacctctgcaagaggaagagtactggtactggaatttgtagatggtagccagtttttagtgtgttcaacttcaaacactgtcctacttg |
237 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45304522 |
atagacctctgcaagatgaagagtactggtactggaatttgtagatggtagccagtttttagtgtgttcaacttcaaacactgtcctacttg |
45304613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University