View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5132_high_10 (Length: 238)
Name: NF5132_high_10
Description: NF5132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5132_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38588642 - 38588422
Alignment:
| Q |
1 |
catgcatggacggatttgataacggaacggacggtgaggatcaagtaaagaaacaattgcaaacagaaagtttggaccaaatggagaaactaaccggcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38588642 |
catgcatggacggatttgataacggaacggacggtgaggatcaagtaaagaaacaattgcaaacagaaagtttggaccaaatggagaaactaaccggcat |
38588543 |
T |
|
| Q |
101 |
tacacttgacattgtaactagcatgtctaacatccttcaaaccttcgacttgaagttggatttgaatccagcttctcgtcgtcttatggaggctaatgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38588542 |
tacacttgacattgtaactagcatgtctaacatccttcaaaccttcgacttgaagttggatttgaatccagcttctcgtcgtcttatggaggctaatgag |
38588443 |
T |
|
| Q |
201 |
attgatgatgaaggattgccc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38588442 |
attgatgatgaaggattgccc |
38588422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University