View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5132_high_4 (Length: 366)
Name: NF5132_high_4
Description: NF5132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5132_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 55095334 - 55095694
Alignment:
| Q |
1 |
tgtaatgtgtatcttgctcttcacttttgttttggtggtactggtagtagtattatcaattctcttattttaattattttcgtaacaatattatattatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55095334 |
tgtaatgtgtatcttgctcttcacttttgttttggt---------agtagtattatcaattctcttattttaattattttcataacaatattatattatc |
55095424 |
T |
|
| Q |
101 |
attgtagtattggtatcacttctcttattatgaa-----ttcctctgagctttggcctggtca---------------ttttatgtaagtgataacatga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55095425 |
attgtagtattggtatcacttctcttattatgaaagaaattcctctgagctttggcctggtcaagctagcccctttctttttatgtaagtgataacatga |
55095524 |
T |
|
| Q |
181 |
attttaaaattactttttaatgtgatactttatagaagctggccccagaagtgtcctatcctaattatccatgataacatggtcggtccgatgggaatat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55095525 |
attttaaaattactttttaatgtgatactttatagaagctggccccagaactgtcctatcctaattatccatgataacatggtcggtccggtgggaatat |
55095624 |
T |
|
| Q |
281 |
gctttttggttgcaattacttaccctgctcaattttgctttttattgccatttttctgccaatctccttt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095625 |
gctttttggttgcaattacttaccctgctcaattttgctttttattgccatttttctgccaatctccttt |
55095694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University