View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5132_low_6 (Length: 331)
Name: NF5132_low_6
Description: NF5132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5132_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 294
Target Start/End: Complemental strand, 29271709 - 29271431
Alignment:
| Q |
16 |
ataattattaagcaaaaattgaagagaactgcatgtttttgagtttgaagagagaatgtgaatcaataaagagataaaatcaacggttttaacgaagcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29271709 |
ataattattaagcaaaaattgaagagaactgcatgtttttgagtttgaagagagaatgtgaatcaataaagagataaaatcaacggttttaacgaagcct |
29271610 |
T |
|
| Q |
116 |
cgttttctctcaacttggtggaagaatttgagagctaatttagggttggacttgtggcttaaaagggttaccaaaaatctannnnnnnnctcggatggtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
29271609 |
cgttttctctcaacttggtggaagaatttgagagctgatttagggttggacttgtggcttaaaagggttaccaaaaatctattttttttctcagatggtt |
29271510 |
T |
|
| Q |
216 |
gagattcgggtgaaatgataattttctcgggaaaatttggggttgaaggaattttctcgggaaagtgttgttgtgtagt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29271509 |
gagattcgggtgaaatgataattttctcgggaaaatttggggttgaaggaattttctcgggaaagtgttgttgtgtagt |
29271431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University