View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5132_low_9 (Length: 268)
Name: NF5132_low_9
Description: NF5132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5132_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 13 - 168
Target Start/End: Original strand, 36732919 - 36733076
Alignment:
| Q |
13 |
atactcagcgataagacaataatagaagtgcgattaac-----ttgcgaatttcaacctcaccacaaattcttaaaattttgttattttagaaatccttc |
107 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
36732919 |
atacttagcgataagacaata---gaagtgcgattaacgtaacttgcgaatttcaacctcaccacaaattcttgaaattttgttattttagaaatccctc |
36733015 |
T |
|
| Q |
108 |
ctaatgagcttgatagtctttcctttaatgatatttttgaatttacatgcttaaaaatatt |
168 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733016 |
ctaatgagcttgatagtctttcttttaatgatatttttgaatttacatgcttaaaaatatt |
36733076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 197 - 242
Target Start/End: Original strand, 36733144 - 36733189
Alignment:
| Q |
197 |
tgaaaaaatttcaactattatctttttatcaccgattgcaatagca |
242 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36733144 |
tgaaaaaatttcaactattatctttctatcaccgattgcaatagca |
36733189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University