View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5133-Insertion-1 (Length: 435)
Name: NF5133-Insertion-1
Description: NF5133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5133-Insertion-1 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 8 - 435
Target Start/End: Complemental strand, 42038406 - 42037979
Alignment:
| Q |
8 |
tgacgcttgtttgacatgacgcttgtatgacatgttgtctagcggactatttggaactctcacaatgatctaatctttgttgggatgatctatttatgtt |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038406 |
tgacgcttgtttgacatggcgcttgtatgacatgttgtctagcggactatttggaactctcacaatgatctaatctttgttgggatgatctatttatgtt |
42038307 |
T |
 |
| Q |
108 |
gagttcttgttggatagggcaaagtttgatcgatagggcaaaattttgatggtggaagtgtttctcggtaaaatcttggcagtgcatacttcttctatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038306 |
gagttcttgttggatagggcaaagtttgatcgatagggcaaaattttgatcgtggaagtgtttctcggtaaaatcttggcagtgcatacttcttctatga |
42038207 |
T |
 |
| Q |
208 |
gtgggagacacatccagccatgagttggaaccgtagaatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaattctcg |
307 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42038206 |
gtgggagacacatccagccgtgagttggaaccgtagaatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaatcctcg |
42038107 |
T |
 |
| Q |
308 |
acagcccattaggtttggtccctctccctgttcccctagggaatgggcaacttccgacgagtagtctggttttggaggttattctcaggtttttgggatg |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42038106 |
acagcccattaggtttggtccctctccctgttcccctagggaatgggcaacttccgacgggtagtctggttttgtaggttattctcaggtttttgggatg |
42038007 |
T |
 |
| Q |
408 |
ttttgtcgctgatgattttgtcgtttat |
435 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
42038006 |
ttttgtcgttgatgattttgtcgtttat |
42037979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University