View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5133_high_10 (Length: 244)
Name: NF5133_high_10
Description: NF5133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5133_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 230
Target Start/End: Complemental strand, 1543487 - 1543267
Alignment:
| Q |
10 |
ataatactataactccaatatataacagcttatacaatcataataaaaaatcaatagattataaagcaacccaaatgttaataacaaattattggtaaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1543487 |
ataatactataactccaatatataacagcttatacaatcataataaaaaatcaatagattataaagcaacccaaaggttaataacaaattattggtaaaa |
1543388 |
T |
 |
| Q |
110 |
tgtctagtcgaaacatttcgtgttttgatccctgctactaacattttccgctcacctatcaaattaaccactaacatttgtctataaaccaatttggtac |
209 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1543387 |
tgtcaagtctaaacatttcgtgttttgatccctgctactaacattttccgctcacctatcaaattaaccactaacatttgtctataaaccaatttggtac |
1543288 |
T |
 |
| Q |
210 |
ttagttgatataattagaaac |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1543287 |
ttagttgatataattagaaac |
1543267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University