View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5133_high_9 (Length: 251)
Name: NF5133_high_9
Description: NF5133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5133_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 5279706 - 5279462
Alignment:
| Q |
9 |
gaagaatatgcaaagatatttttgcaatacatttaactaacggctttgactttgttatggtggcatgattgatgacggtaacgtcaaatacatttccgta |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5279706 |
gaagaaaatgcaaagatatttttgcaatacatttaactaacggctttgactttgttatggtggcatgattgatgacggtaacgtcaaatacatttccgta |
5279607 |
T |
|
| Q |
109 |
tgtaaatgtacttggttgctgtcattgactt---agatatatgcatcaaaataactttttctgttatgattttacaaggaaaatggattaactatagtac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5279606 |
tgtaaatgtacttggttgctgtcattgacttggatgatatatgcatcaaaataactttttctgttgtgattttacaaggaaaatggattaactatagtac |
5279507 |
T |
|
| Q |
206 |
aagggataccctaaattcatcacaacattcattctatatacactt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5279506 |
aagggataccctaaattcatcacaacattcattctatatacactt |
5279462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University