View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5134-Insertion-5 (Length: 297)
Name: NF5134-Insertion-5
Description: NF5134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5134-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 7 - 282
Target Start/End: Complemental strand, 30411494 - 30411219
Alignment:
| Q |
7 |
agataattgatttctgcctaaaatataaggtttaattagtctcatcagaattctcatctgtcataatctatttaatttgctaaagaaaataagtttcata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30411494 |
agataattgatttctgcctaaaatataaggtttaattagtctcatcagaattctcatctgtcataatctatttaatttgctaaagaaaataagtttcata |
30411395 |
T |
|
| Q |
107 |
aacttcaaaatgaaataataaaatgacactcaccaaccattcattctgtcccagttggctgctttctttgataaacatcttaacagcaacaacataacca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30411394 |
aacttcaaaatgaaataataaaatgacactcaccaaccattcattctgtcccagttggctgctttctttgataaacatcttaacagcaacaacataacca |
30411295 |
T |
|
| Q |
207 |
gtaccttgtttagtaggagctagcttgtgctcatcgatccaccccttaaagacactaccaaacccacgttcatcca |
282 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30411294 |
gtaccttgtttagtaggagctagcgtgtgctcatcgatccaccccttaaagacactaccaaacccacgttcatcca |
30411219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 131 - 280
Target Start/End: Complemental strand, 30408443 - 30408297
Alignment:
| Q |
131 |
gacactcaccaaccattcattctgtcccagttggctgctttctttgataaacatcttaacagcaacaacataaccagtaccttgtttagtaggagctagc |
230 |
Q |
| |
|
||||||||||||||||||| | ||| || ||| ||||||| ||| |||||||| | |||||||||||| ||||||||||| |||| ||||||||| || |
|
|
| T |
30408443 |
gacactcaccaaccattcactatgttcc---tggttgctttcattgttaaacatcatcacagcaacaacaaaaccagtacctggtttcgtaggagcttgc |
30408347 |
T |
|
| Q |
231 |
ttgtgctcatcgatccaccccttaaagacactaccaaacccacgttcatc |
280 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||| ||||||||||| |
|
|
| T |
30408346 |
atgtgctcatcgatccaccccttgaataccctaccaaatccacgttcatc |
30408297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 125 - 273
Target Start/End: Complemental strand, 30421487 - 30421342
Alignment:
| Q |
125 |
taaaatgacactcaccaaccattcattctgtcccagttggctgctttctttgataaacatcttaacagcaacaacataaccagtaccttgtttagtagga |
224 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||| || |||||||||| | ||| | |||| ||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
30421487 |
taaaatgagactcaccaaccattcactatgtccc---tgactgctttcttggttaagcctcttgacagcaataacaaaaccagtacctggtttagtagga |
30421391 |
T |
|
| Q |
225 |
gctagcttgtgctcatcgatccaccccttaaagacactaccaaacccac |
273 |
Q |
| |
|
||||| |||||||||||||||| |||||||| |||| |||||| |||| |
|
|
| T |
30421390 |
gctagtgtgtgctcatcgatccaacccttaaatacacaaccaaatccac |
30421342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 273
Target Start/End: Complemental strand, 30404555 - 30404484
Alignment:
| Q |
202 |
aaccagtaccttgtttagtaggagctagcttgtgctcatcgatccaccccttaaagacactaccaaacccac |
273 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||||||||||| |||||||| |||| |||||| |||| |
|
|
| T |
30404555 |
aaccagtaccttgtttagtcggggctagtgtgtgctcatcgatccaacccttaaatacacaaccaaatccac |
30404484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University