View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5135_high_2 (Length: 251)
Name: NF5135_high_2
Description: NF5135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5135_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 24 - 222
Target Start/End: Complemental strand, 8908567 - 8908369
Alignment:
| Q |
24 |
aatatattctttatttttgaattcttaaaatcatggggtgtgtgctatcttctactttttctatgctataatataataatacaaaagtacataaagtaag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8908567 |
aatatattctttatttttgaattcttaaaatcatggggtgtgtgctatcttctactttttctatgctataatataataatacaaaagtacataaagtaag |
8908468 |
T |
 |
| Q |
124 |
tcatactctcatcactactagtcgtcaccttatgccatgtaagagaaagacaaagagaggaatatatgtgaataacttttttcttatggagtttgtatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8908467 |
tcatactctcatcactactagtcgtcaccttatgccatgtaagagaaagacaaagagaggaatatatgtgaataacttttttcttatggagtttgtatt |
8908369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University