View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5135_low_2 (Length: 282)
Name: NF5135_low_2
Description: NF5135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5135_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 9 - 172
Target Start/End: Complemental strand, 8908751 - 8908588
Alignment:
| Q |
9 |
gagatgaagagtgtaaggagatagaagagaatagagaaagatatgaggttggagatttgtgtgaaaaatggttaaggtgaaaggtggtatttataggggt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8908751 |
gagaagaagagtgtaaggagatagaagagattagagaaagatatgaggttggagatttgtgtgaaaaatggttaaggtgaaaggtggtatttataggggt |
8908652 |
T |
 |
| Q |
109 |
ttatttagggtgtaagagaatatatcatatctaaggctatatgagagtggatcagtggagtgtg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8908651 |
ttatttagggtgtaagagaatatatcatatctaaggctatatgagagtggatcagtggagtgtg |
8908588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University