View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5135_low_4 (Length: 245)
Name: NF5135_low_4
Description: NF5135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5135_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7309811 - 7309590
Alignment:
| Q |
1 |
tatagttctcgaaagagacgtaggaatgatgaatctcaaaatgatgattctgaaaatgatcatgaaataatgagcacacaaacttcgtctgattattctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309811 |
tatagttctcgaaagagacgtaggaatgatgaatctcaaaatgatgattctgaaaatgatcatgaaataatgagcacacaaacttcgtctgattattctt |
7309712 |
T |
|
| Q |
101 |
atcgaaatagacataggattgatgatcctgaatctggttctgatgatgatcatgatcatgaaagaataagaaatgcttctcgaaacagacgtgcgattga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7309711 |
atcgaaataggcataggattgatgattttggatctggttctgatgatgatcatgatcatgaaagaataagaaatgcttctcgaaatagacgtgcgattga |
7309612 |
T |
|
| Q |
201 |
gattgatgaatataattctgaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7309611 |
gattgatgaatataattctgaa |
7309590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University