View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5135_low_5 (Length: 242)
Name: NF5135_low_5
Description: NF5135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5135_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 31280723 - 31280946
Alignment:
| Q |
1 |
tgaaagaacctgcaaagaagaatatgtataaaagcatatcagcagcatacactgtgatagttttgagttactggcagttggctttctgtggatattgggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31280723 |
tgaaagaacctgcaaagaagaatatgtataaaagcatatcagcagcatacactgtgatagttttgagttactggcagttggctttctgtggatattgggc |
31280822 |
T |
|
| Q |
101 |
ttttggatcacaagtccaaccttacattttagcttctctttccattccagaatggactgttgttatggcaaatttatttgcagctattcaaatatgtgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31280823 |
ttttggatcacaagtccaaccttacattttagcttctctttccattccagaatggactgttgttatggcaaatttatttgcagctattcaaatatgtgga |
31280922 |
T |
|
| Q |
201 |
tgctttcaggtaaagtctcttata |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31280923 |
tgctttcaggtaaagtctcttata |
31280946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University