View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5135_low_6 (Length: 234)
Name: NF5135_low_6
Description: NF5135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5135_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 4064273 - 4064422
Alignment:
| Q |
1 |
tggaattgtaaggctaacgatattattgatgcagctaattgttatct-ccacgtaataaaatgagagaaaattaagaaggatatagaaac-gaatttatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| | ||||||| || |||||||||||||| ||||||||| |
|
|
| T |
4064273 |
tggaattgtaaggctaacgatattattgatgcagctaattgttatcttccatataattatatgagagcaag----gaaggatatagaaaatgaatttatt |
4064368 |
T |
|
| Q |
99 |
ttcttgtttctttgaaaagttatgattatacgtgttcttaagaagaaaataaatc |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4064369 |
ttcttgtttctt-gaaaagttatgattatacgtgttcttaagaagaaaataaatc |
4064422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 4064417 - 4064459
Alignment:
| Q |
177 |
taaatcaacggatattttatctctgttttgctttttggtttct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4064417 |
taaatcaacggatattttatctctgttttgctttttggtttct |
4064459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University