View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5135_low_6 (Length: 234)

Name: NF5135_low_6
Description: NF5135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5135_low_6
NF5135_low_6
[»] chr4 (2 HSPs)
chr4 (1-153)||(4064273-4064422)
chr4 (177-219)||(4064417-4064459)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 4064273 - 4064422
Alignment:
1 tggaattgtaaggctaacgatattattgatgcagctaattgttatct-ccacgtaataaaatgagagaaaattaagaaggatatagaaac-gaatttatt 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||  |||| | ||||||| ||     ||||||||||||||  |||||||||    
4064273 tggaattgtaaggctaacgatattattgatgcagctaattgttatcttccatataattatatgagagcaag----gaaggatatagaaaatgaatttatt 4064368  T
99 ttcttgtttctttgaaaagttatgattatacgtgttcttaagaagaaaataaatc 153  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
4064369 ttcttgtttctt-gaaaagttatgattatacgtgttcttaagaagaaaataaatc 4064422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 177 - 219
Target Start/End: Original strand, 4064417 - 4064459
Alignment:
177 taaatcaacggatattttatctctgttttgctttttggtttct 219  Q
    |||||||||||||||||||||||||||||||||||||||||||    
4064417 taaatcaacggatattttatctctgttttgctttttggtttct 4064459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University