View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5137-Insertion-13 (Length: 109)
Name: NF5137-Insertion-13
Description: NF5137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5137-Insertion-13 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 1e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 11 - 109
Target Start/End: Complemental strand, 36722754 - 36722656
Alignment:
| Q |
11 |
cgtcgggctgaggttttgaaatttgttgagcctgaagttgttcaggttaattggcctacttcaagcagtatgagtagtactgttgaatctttgactggg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36722754 |
cgtcgggctgaggttttgaaatttgttgaacctgaagttgttcaggttaattggcctacttcaagcagtatgagtagtactgttgaatctttgagtggg |
36722656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 16 - 102
Target Start/End: Complemental strand, 36709880 - 36709794
Alignment:
| Q |
16 |
ggctgaggttttgaaatttgttgagcctgaagttgttcaggttaattggcctacttcaagcagtatgagtagtactgttgaatcttt |
102 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
36709880 |
ggctgaggttttgaaatttgttgagccagatgttgttcaggttaattggcctacttcaagcggtatgagtagtaccgttgagtcttt |
36709794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University