View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5138_low_3 (Length: 264)
Name: NF5138_low_3
Description: NF5138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5138_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 108 - 248
Target Start/End: Original strand, 22473984 - 22474121
Alignment:
| Q |
108 |
acttcatggattcaagattctgagcctcattatgataaaagtacttcttcttgcatcaacaaattaggtactgagtttaacttctcttgtgttaccttgc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
22473984 |
acttcatggattcaagattctgagcctcattatgataaaagtacttcttcttgcaccaacaaa---ggtaccgagtttaacttctcttgtgttaccttgc |
22474080 |
T |
 |
| Q |
208 |
aaatttctagctatagccgactcattcatgtgagttaaatt |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22474081 |
aaatttgtagctatagccgactcattcatgtgagttaaatt |
22474121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 124 - 248
Target Start/End: Complemental strand, 22474838 - 22474713
Alignment:
| Q |
124 |
attctgagcctcattatgataaaagta----cttcttcttgcatcaacaaattaggtactgagtttaacttctcttgtgttaccttgcaaatttctagct |
219 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||| |||||| ||||| |||| |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
22474838 |
attctgaacctcattatgataaaagtagttacttcttcttgcacgaacaaa---ggtaccaagttcaacttctcttgtgttaccctgcaaatttgtagct |
22474742 |
T |
 |
| Q |
220 |
atagccgactcattcatgtgagttaaatt |
248 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
22474741 |
atagctgactcattcatgtgagttaaatt |
22474713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University