View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139-Insertion-7 (Length: 180)
Name: NF5139-Insertion-7
Description: NF5139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 7e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 7e-94
Query Start/End: Original strand, 7 - 180
Target Start/End: Original strand, 47536349 - 47536522
Alignment:
| Q |
7 |
aggaagatgcactggttgtgtatactttagctgattcttcattttcttcagcagctgagaaggcctgcaaattatggggtgtgccttctaccaatgtact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47536349 |
aggaagatgcactggttgtgtatactttagctgattcttcattttcttcagcagctgagaaggcctgcaaattatggggtgtgccttctaccaatgtact |
47536448 |
T |
|
| Q |
107 |
aggacccattacagaggccattgcttctcatctgggtgtgtctccttctggccttcctcgtggtgcttctggcg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47536449 |
aggacccattacagaggccattgcttctcatctgggtgtgtctccttctggccttcctcgtggtgcttctggcg |
47536522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University