View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_high_13 (Length: 288)
Name: NF5139_1D_high_13
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 24 - 280
Target Start/End: Complemental strand, 54895255 - 54894999
Alignment:
| Q |
24 |
gttatagagatcgttctccggtcgcgtttggtggcgaggagctgagtgtggatcctgttgagacgtccacgtcagcagatagcatttctgttacgattcg |
123 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895255 |
gttatagagatcgttctccggttgcgtttggtggcgaggagctgagtgtggatcctgttgagacgtccacgtcagcagatagcatttctgttacgattcg |
54895156 |
T |
|
| Q |
124 |
gtttcgtccattgaggtaagggtttagatctgtgtttcgatttcagatccattgtgtgttactgaatgattttgttgcagtgaaagggaatataataaag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895155 |
gtttcgtccattgaggtaagggtttagatctgtgtttcgatttcagatccattgtgtgttactgaatgattttgttgcagtgaaagggaatataataaag |
54895056 |
T |
|
| Q |
224 |
gggatgaaatcgcgtggtatgctgatggtgataagattgttagaaatgagtataatc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54895055 |
gggatgaaatcgcgtggtatgctgatggtgataagattgttagaaatgagtataatc |
54894999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 197 - 280
Target Start/End: Complemental strand, 26859416 - 26859333
Alignment:
| Q |
197 |
gttgcagtgaaagggaatataataaaggggatgaaatcgcgtggtatgctgatggtgataagattgttagaaatgagtataatc |
280 |
Q |
| |
|
||||||||||||| || ||| ||| ||| || ||||| ||||||||||||||||||||||||||||| || ||||||| ||||| |
|
|
| T |
26859416 |
gttgcagtgaaagagagtatcatagaggagacgaaattgcgtggtatgctgatggtgataagattgtgaggaatgagtttaatc |
26859333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University