View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_high_19 (Length: 208)
Name: NF5139_1D_high_19
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 2154894 - 2155065
Alignment:
| Q |
18 |
ggaccaactaatctgaggaattcaatctcaacgtctacttgtaataaatatgataatgaccaacttataaaagaagttgagataattcatgttctgatag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
2154894 |
ggaccaactaatctgaggaattcaatctcaacgtctacttgtaataaatatgataatgaccaacttataaaagaagttgagatagttcacgttctgatag |
2154993 |
T |
 |
| Q |
118 |
taataaataggattcagaatattaaatcacaatataaatagtttgatctgtattcaacgattatgaccaatg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2154994 |
taataaataggattcagaatattaaatcacaatatgaatagtttgatctgtattcaacgattatgaccaatg |
2155065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University