View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_low_23 (Length: 257)
Name: NF5139_1D_low_23
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_low_23 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 52 - 257
Target Start/End: Complemental strand, 54894184 - 54893979
Alignment:
| Q |
52 |
agtgcttatgctacatggcggctacttcttgttagcgttgcctttttgtacaatttttgtgcggaatgtaggttggagtaatattctagctgttgctata |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54894184 |
agtgcttatgctacatggcggctacttcttgttagcgttgcctttttgtacaatttttgtgcggaatgtaggttggagtaatattctagctgttgcttta |
54894085 |
T |
|
| Q |
152 |
tgttttagtagccaaagatcacgtctcataagattagtttttgggtaatttataaagggttttgattcacttacagttgatacattttctcttcttccga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54894084 |
tgttttagtagccaaagatcacgtctcataagattagtttttgggtaatttataaagggttttgattcacttacagttgatacattttttcttcttccga |
54893985 |
T |
|
| Q |
252 |
ggtatt |
257 |
Q |
| |
|
|||||| |
|
|
| T |
54893984 |
ggtatt |
54893979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 2 - 55
Target Start/End: Complemental strand, 54894325 - 54894272
Alignment:
| Q |
2 |
cctttcatcaatcatcatattgcaattctttagtttgttatttagattacagtg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54894325 |
cctttcatcaatcatcatattgcaattctttagtttgttatttagattacagtg |
54894272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University