View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_low_26 (Length: 254)
Name: NF5139_1D_low_26
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_low_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 7267572 - 7267319
Alignment:
| Q |
1 |
gtggaatgctattcatcttcctttcttgcatctcaagtagaaaaccacaaaaagaacaaaatgttaatctttaaacacaactatctaacgcggtgtctct |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7267572 |
gtggaatgctactcatcttcctttcttgcatctcaagtagaaaaccacaaaaagaacaaaatgttaatctttaaacataactatctaacgcggtgtctct |
7267473 |
T |
 |
| Q |
101 |
gcaggtacatgaaagtactttcaattttcagatcttcaacacgtaaaaggcctttagagatcaatcccatgcgtcagctagagaagaaaatatggttcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7267472 |
gcaggtacatgaaagtactttcaattttcagatcttcaacacgtaaaaggcctttagagatcaatcccatgcgtcagctagagaagaaaatatgcttcta |
7267373 |
T |
 |
| Q |
201 |
ctgcttcattaatactgaaacaatataatagtattaatagtaacccttagatca |
254 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7267372 |
ctgcttcattaataatgaaacaatataatagtattaatagtaacccttagatca |
7267319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University