View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_low_32 (Length: 222)
Name: NF5139_1D_low_32
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 3 - 216
Target Start/End: Complemental strand, 35250045 - 35249832
Alignment:
| Q |
3 |
tttggagttaagttgttacatttattatgtgtggcgtaggtccatgacaggagtgagtgtttggtggtccaaatccaaacaactgcatgctgtatattgt |
102 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35250045 |
tttggtgtgaagttgttacatttattatgtgtggcgtaggtccatgacaggagtgagtgtttggtggtccaaatccaaacaactgcatgctgtatattgt |
35249946 |
T |
|
| Q |
103 |
acatcgttagttactttgacggtcagtcggtcacatgttcatgtattacataaatgaaaaaatttatttgcactcaaatgttattatacaccttgagagg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35249945 |
acatcgttagttactttgacggtcagtcggtcacatgttcatgcattacataaatgaaaaaatttatttgcactcaaatgttattctacaccttgagagg |
35249846 |
T |
|
| Q |
203 |
tagatagaaataaa |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35249845 |
tagatagaaataaa |
35249832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University