View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_low_33 (Length: 219)
Name: NF5139_1D_low_33
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_low_33 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 54894621 - 54894839
Alignment:
| Q |
1 |
acctgtttattctagtaaaaataaagatatcatatgaaactaaaacagcattgatcaatccatgaaaatggcttggtgcttggtagtacaaaatcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54894621 |
acctgtttattctagtaaaaataaagatatcacatgaaactaaaacagcattgatcaatccatgaaaatggcttggtgcttggtagtacaaaatcaaaat |
54894720 |
T |
|
| Q |
101 |
caaactctactcacacaacacttctaaattagcctcaattccagaattagcatttcataccattgacaccttccatggcagccttcaccacaggtttggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54894721 |
caaactctactcacacaacacttctaaattagcctcaattccagaattagcatttcataccattgacaccttccatggcagccttcaccacaggtttggc |
54894820 |
T |
|
| Q |
201 |
agctacttcatacacctcg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
54894821 |
agctacttcatacacctcg |
54894839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 218
Target Start/End: Original strand, 26858920 - 26858980
Alignment:
| Q |
158 |
taccattgacaccttccatggcagccttcaccacaggtttggcagctacttcatacacctc |
218 |
Q |
| |
|
||||||| || ||||||||||| |||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
26858920 |
taccattaaccccttccatggctgccttcacgacaggttttgctgctacttcatacacctc |
26858980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University