View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5139_1D_low_35 (Length: 212)

Name: NF5139_1D_low_35
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5139_1D_low_35
NF5139_1D_low_35
[»] chr5 (2 HSPs)
chr5 (7-134)||(33854557-33854684)
chr5 (158-211)||(33756779-33756832)


Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 33854557 - 33854684
Alignment:
7 taaattaatgaacaaatatgaatactaaaacattaaaatcattgannnnnnnnnnnaagcaaacttttttattaatgagattataaaaaagtaatcctta 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||    
33854557 taaattaatgaacaaatatgaatactaaaacattaaaatcattgatttttttttttaagcaaacttttttattaatgagattataaaaaagtaatcctta 33854656  T
107 cagcaaaagtaatccgaattcatcagta 134  Q
    ||||||||||||||||||||||||||||    
33854657 cagcaaaagtaatccgaattcatcagta 33854684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 33756779 - 33756832
Alignment:
158 ttctatgaatggttgtacgcagtgtacccgctatatcaagttctccaaattcag 211  Q
    ||||||||||||||| | ||||||||||||| ||||||||||||||||||||||    
33756779 ttctatgaatggttgcatgcagtgtacccgccatatcaagttctccaaattcag 33756832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University