View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_low_35 (Length: 212)
Name: NF5139_1D_low_35
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 33854557 - 33854684
Alignment:
| Q |
7 |
taaattaatgaacaaatatgaatactaaaacattaaaatcattgannnnnnnnnnnaagcaaacttttttattaatgagattataaaaaagtaatcctta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33854557 |
taaattaatgaacaaatatgaatactaaaacattaaaatcattgatttttttttttaagcaaacttttttattaatgagattataaaaaagtaatcctta |
33854656 |
T |
 |
| Q |
107 |
cagcaaaagtaatccgaattcatcagta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33854657 |
cagcaaaagtaatccgaattcatcagta |
33854684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 33756779 - 33756832
Alignment:
| Q |
158 |
ttctatgaatggttgtacgcagtgtacccgctatatcaagttctccaaattcag |
211 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33756779 |
ttctatgaatggttgcatgcagtgtacccgccatatcaagttctccaaattcag |
33756832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University