View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5139_1D_low_39 (Length: 208)

Name: NF5139_1D_low_39
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5139_1D_low_39
NF5139_1D_low_39
[»] chr1 (1 HSPs)
chr1 (18-189)||(2154894-2155065)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 2154894 - 2155065
Alignment:
18 ggaccaactaatctgaggaattcaatctcaacgtctacttgtaataaatatgataatgaccaacttataaaagaagttgagataattcatgttctgatag 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||    
2154894 ggaccaactaatctgaggaattcaatctcaacgtctacttgtaataaatatgataatgaccaacttataaaagaagttgagatagttcacgttctgatag 2154993  T
118 taataaataggattcagaatattaaatcacaatataaatagtttgatctgtattcaacgattatgaccaatg 189  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
2154994 taataaataggattcagaatattaaatcacaatatgaatagtttgatctgtattcaacgattatgaccaatg 2155065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University